Jolta Posted November 22, 2009 Report Share Posted November 22, 2009 I use the Omnitrix to turn into Upgrade. Link to comment Share on other sites More sharing options...
Compass Posted November 22, 2009 Report Share Posted November 22, 2009 I continue spouting Deoxyribonucleic acid junk. Link to comment Share on other sites More sharing options...
Horologia Posted November 22, 2009 Author Report Share Posted November 22, 2009 Would you please stop it 0_0 all of youIm getting scared... ...and you stop to your researching!!! (Hitting him with Mario vs Donkey-kong Hammer, out of Super Smash Brothers) Link to comment Share on other sites More sharing options...
Compass Posted November 22, 2009 Report Share Posted November 22, 2009 "What?" He looks at her, mad. "ATGCGCGCGCGCATGCGCGCGCATATATATATATATATATATATATATATATCGAT CGATCGAT..." Link to comment Share on other sites More sharing options...
I AM BIB Posted November 22, 2009 Report Share Posted November 22, 2009 Security is back, Behave. Link to comment Share on other sites More sharing options...
I AM BIB Posted November 22, 2009 Report Share Posted November 22, 2009 Bordem Strikes... Link to comment Share on other sites More sharing options...
Compass Posted November 22, 2009 Report Share Posted November 22, 2009 *Sips drink boredly, reciting DNA strand. Link to comment Share on other sites More sharing options...
Don Shadow Posted November 22, 2009 Report Share Posted November 22, 2009 is it AM or PM?timing affectsAM: stays normalPM: turns into were-wolf form and starts beating up the bad guys.i'd like to apply for security. Link to comment Share on other sites More sharing options...
Žäīἢ Posted November 22, 2009 Report Share Posted November 22, 2009 hey, n e body here?guess not, i ll watch the place 4 holo then*takes a seat at the bar* Link to comment Share on other sites More sharing options...
Jolta Posted November 23, 2009 Report Share Posted November 23, 2009 *Uses Omnitrix to turn into Chuck Norris* Link to comment Share on other sites More sharing options...
Imma Mario Posted November 23, 2009 Report Share Posted November 23, 2009 Can I have a glass of gassoline on the rocks and a Bucket of Mud please. Link to comment Share on other sites More sharing options...
Compass Posted November 23, 2009 Report Share Posted November 23, 2009 "This ATGCATATisGCGCGCATreallyATGCATGCGCrandomAtatatat..." He kept right on reciting. Link to comment Share on other sites More sharing options...
Imma Mario Posted November 23, 2009 Report Share Posted November 23, 2009 "This ATGCATATisGCGCGCATreallyATGCATGCGCrandomAtatatat..." He kept right on reciting. *Calls Alchohol Poisoning Help Company* Link to comment Share on other sites More sharing options...
Horologia Posted November 23, 2009 Author Report Share Posted November 23, 2009 *Handing him a mobile phone to do so ^^* Link to comment Share on other sites More sharing options...
.Nu-13 Posted November 23, 2009 Report Share Posted November 23, 2009 Give me some water, Fraulein Link to comment Share on other sites More sharing options...
Amaterasu Posted November 23, 2009 Report Share Posted November 23, 2009 The band is back in town. I open with Iron Maiden - Iron Maiden.  Won't you come into my room, I wanna show you all my wares.I just want to see your blood, I just want to stand and stare.See the blood begin to flow as it falls upon the floor.Iron Maiden can't be faught, Iron Maiden can't be sought... Link to comment Share on other sites More sharing options...
I AM BIB Posted November 23, 2009 Report Share Posted November 23, 2009 My fist is going to collide with ami's face for no reason... Link to comment Share on other sites More sharing options...
Amaterasu Posted November 23, 2009 Report Share Posted November 23, 2009 Chicken Wire Stage! I play Kobold Asylum's song, Same Forward As Backward. Link to comment Share on other sites More sharing options...
Horologia Posted November 23, 2009 Author Report Share Posted November 23, 2009 Ey... dont kill my band-dude >=( Need him too much for that ^^ Link to comment Share on other sites More sharing options...
Amaterasu Posted November 23, 2009 Report Share Posted November 23, 2009 Any more Requests? I am going AFK for a bit. Link to comment Share on other sites More sharing options...
Horologia Posted November 23, 2009 Author Report Share Posted November 23, 2009 Manowar - House of Death please ^^ Link to comment Share on other sites More sharing options...
I AM BIB Posted November 23, 2009 Report Share Posted November 23, 2009 sorry boss. Link to comment Share on other sites More sharing options...
Amaterasu Posted November 23, 2009 Report Share Posted November 23, 2009 Manowar is now being played. Skulduggery Pleasant. Please see me backstage for an autograph. Link to comment Share on other sites More sharing options...
I AM BIB Posted November 23, 2009 Report Share Posted November 23, 2009 ??? What from me or to me? Link to comment Share on other sites More sharing options...
Amaterasu Posted November 23, 2009 Report Share Posted November 23, 2009 Me give you an autograph. I am a band you know. Link to comment Share on other sites More sharing options...
Recommended Posts
Archived
This topic is now archived and is closed to further replies.